EP3798306A1 — Complement component irna compositions and methods of use thereof
Assigned to Alnylam Pharmaceuticals Inc · Expires 2021-03-31 · 5y expired
What this patent protects
The present invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of complement component C3 in a cell, wherein said dsRNA comprises a sense strand and an antisense strand, wherein each strand comprises 15-30 nucleotides and said strands form a…
USPTO Abstract
The present invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of complement component C3 in a cell, wherein said dsRNA comprises a sense strand and an antisense strand, wherein each strand comprises 15-30 nucleotides and said strands form a double-stranded region, and wherein the antisense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the following antisense sequences:a. GAGAGAAGACCUUGACCACGUAG (SEQ ID NO:282);b. UAGAGAAGACCUUGACCACGUAG (SEQ ID NO:267);c. AGAGAGAAGACCUUGACCACGUA (SEQ ID NO:266);d. AGAGAAGACCUUGACCACGUAGG (SEQ ID NO:299); and wherein at least one nucleotide in said dsRNA comprises a modification.
Drugs covered by this patent
Bibliographic data sourced from FDA Orange Book + USPTO public records. Plain-English summary generated by AI grounded in source text. Patent term extensions (PTR, SPC, pediatric) may shift the effective expiry. Not legal advice.
Track this patent
Get a daily-checked alert when vulnerability score, expiry, classification, or assignee changes. Email, Slack, or Teams delivery. Pro: 50 watches, Free: 3.