EP Patent

EP3798306A1 — Complement component irna compositions and methods of use thereof

Assigned to Alnylam Pharmaceuticals Inc · Expires 2021-03-31 · 5y expired

What this patent protects

The present invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of complement component C3 in a cell, wherein said dsRNA comprises a sense strand and an antisense strand, wherein each strand comprises 15-30 nucleotides and said strands form a…

USPTO Abstract

The present invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of complement component C3 in a cell, wherein said dsRNA comprises a sense strand and an antisense strand, wherein each strand comprises 15-30 nucleotides and said strands form a double-stranded region, and wherein the antisense strand comprising at least 15 contiguous nucleotides differing by no more than 3 nucleotides from any one of the following antisense sequences:a. GAGAGAAGACCUUGACCACGUAG (SEQ ID NO:282);b. UAGAGAAGACCUUGACCACGUAG (SEQ ID NO:267);c. AGAGAGAAGACCUUGACCACGUA (SEQ ID NO:266);d. AGAGAAGACCUUGACCACGUAGG (SEQ ID NO:299); and wherein at least one nucleotide in said dsRNA comprises a modification.

Drugs covered by this patent

Patent Metadata

Patent number
EP3798306A1
Jurisdiction
EP
Classification
Expires
2021-03-31
Drug substance claim
No
Drug product claim
No
Assignee
Alnylam Pharmaceuticals Inc
Source
FDA Orange Book + USPTO grounding via Google Patents

Bibliographic data sourced from FDA Orange Book + USPTO public records. Plain-English summary generated by AI grounded in source text. Patent term extensions (PTR, SPC, pediatric) may shift the effective expiry. Not legal advice.

Track this patent

Get a daily-checked alert when vulnerability score, expiry, classification, or assignee changes. Email, Slack, or Teams delivery. Pro: 50 watches, Free: 3.