EP Patent

EP3693463A1 — Compositions and methods for inhibiting expression of the alas1 gene

Assigned to Icahn School of Medicine at Mount Sinai · Expires 2020-08-12 · 6y expired

What this patent protects

The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript, which antisense str…

USPTO Abstract

The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 22 contiguous nucleotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).

Drugs covered by this patent

Patent Metadata

Patent number
EP3693463A1
Jurisdiction
EP
Classification
Expires
2020-08-12
Drug substance claim
No
Drug product claim
No
Assignee
Icahn School of Medicine at Mount Sinai
Source
FDA Orange Book + USPTO grounding via Google Patents

Bibliographic data sourced from FDA Orange Book + USPTO public records. Plain-English summary generated by AI grounded in source text. Patent term extensions (PTR, SPC, pediatric) may shift the effective expiry. Not legal advice.

Track this patent

Get a daily-checked alert when vulnerability score, expiry, classification, or assignee changes. Email, Slack, or Teams delivery. Pro: 50 watches, Free: 3.