EP3693463A1 — Compositions and methods for inhibiting expression of the alas1 gene
Assigned to Icahn School of Medicine at Mount Sinai · Expires 2020-08-12 · 6y expired
What this patent protects
The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript, which antisense str…
USPTO Abstract
The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of ALAS1, wherein said dsRNA comprises a sense strand and an antisense strand, the antisense strand comprising a region of complementarity to an ALAS1 RNA transcript, which antisense strand comprises at least 22 contiguous nucleotides from the antisense sequence of UAAGAUGAGACACUCUUUCUGGU (SEQ ID NO: 4153) or UAAGAUGAGACACUCTUUCUGGU (SEQ ID NO: 4154).
Drugs covered by this patent
Bibliographic data sourced from FDA Orange Book + USPTO public records. Plain-English summary generated by AI grounded in source text. Patent term extensions (PTR, SPC, pediatric) may shift the effective expiry. Not legal advice.
Track this patent
Get a daily-checked alert when vulnerability score, expiry, classification, or assignee changes. Email, Slack, or Teams delivery. Pro: 50 watches, Free: 3.